Identifying human miRNA target sites via learning the interaction patterns between miRNA and mRNA segments

Related paper:

Tzu-Hsien Yang, Jhih-Cheng Chen, Shang-Hang Wu, Fang-Yuan Zhang, Yan-Cheng Huang, Mei-Hsien Lee, Yan-Yuan Tseng and Wei-Sheng Wu*, "Identifying human miRNA target sites via learning the interaction patterns between miRNA and mRNA segments." (Submitting)

Available Datasets:

1. Training Data
2. Test Data

Model Codes for the Proposed Method

Suggested running environments: Linux Ubuntu 16.04, Python 3.8.0

1. Download the codes from the following link: Download.
2. Unzip the file:
   unzip miRNA_mRNA_binding_predict_code.zip
3. Change the working directory into the model codes:
   cd miRNA_mRNA_binding_predict
4. Install the necessary packages:
   pip install -r requirements.txt
5. Prepare the miRNA-mRNA sequence pairs in the folder name "Input".
   Multiple miRNA-mRNA pairs are allowed to be in the same input file. The input format should followed the following examples:
   <miRNA sequence>,<mRNA sequence>
   Note: 1.The input miRNA sequences and mRNA sequences should all start from the 5' end.
              2.The input miRNA sequence must be padded to 30nt with "L".
   ACCCCACTCCTGGTACCLLLLLLLLLLLLL,CCATTTCAGCAACTGGCTTGCTACTACCCTCAGCATATTT
   AACTGGCCCTCAAAGTCCCGCTLLLLLLLL,TGGAACATGTGGGGGATCTCCCTAAGCTCTGGCCACAGCA
   
6. Predict the binding probability of the given miRNA sequences and mRNA sequence segments:
   python main.py --input_file_name <Input_file_name>
7. Output: Probability of the binding events for each pairs will be written to 'Output_<Input_file_name>.csv'.